19+ puc-gw-kan vector

The PC-GW vectors use the. We offer the standard vectors pUCAmp and pUCKan as well as our modified vectors pUCAmpMinusMCS and pUCKanMinusMCS.


Addgene Deltanp63alpha Flag

Vector database is a digital collection of vector backbones assembled from publications and commercially available sources.

. This is a free resource for the scientific community that is. Sequence Mod Senin 31 Oktober 2022. 19 puc-gw-kan vector The designation pUC is derived from the classical p prefix denoting plasmid and the.

It is a small plasmid with a. PUC vectors used as cloning vectors and they Senin 31 Oktober. Puc-gw-kan sequence 2626bp tcgcgcgtttcggtgatgacggtgaaaacctctgacacatgcagctcccggagactgtcacagcttgtctgtaagcggatgccg.

The final construct is verified with both Sanger DNA sequencing on at least one strand and. S8 dq 6htxhqfh es 777777777777 77777777777. M13F 47 M13 XapI SacI KpnI Bsp68I 5 C GCC AGG GTT T T C CCA GTC ACG ACG T T G TAA AAC GAC GGC CAG AGA ATT CGA GCT CGG.

It is a commonly used cloning vector in the bacteria E. KP826769-KP826773 for Agrobacterium-mediated plant transformation. 19 puc-gw-kan vector S8 dq 6htxhqfh es 777777777777 77777777777.

The assembled full-length gene is cloned into the pUC-GW-KanAmp vector via the EcoRV site. We have developed a novel binary vector series named the PC-GW series GenBank. This material is available to academics and nonprofits only.

1 pUC57Kan Vector Map Multiple Cloning Sites. PUC19 is 2686 bp in length. Backbone Vector backbone pUC-GW-Kan Search Vector Database Backbone manufacturer GeneWiz Vector type BxbI site specific.

It is a commonly used cloning vector in the bacteria E. Our modified vectors lack multiple cloning sites. SnapGene Viewer is free software that allows molecular biologists to create browse and share richly annotated sequence files.

The molecular weight of the pUC19 vector is 17510 6 Da. Gain unparalleled visibility of your plasmids DNA and protein.


Addgene 1352wuv2 Kpn1 Bamh1 Stop


Puc19 Plasmid Cloning Vector Amid Biosciences Protein Engineering Company


Puc19 Wikipedia


19 Puc Gw Kan Vector Kerianruaidhri


Addgene Vector Database Pidtsmart Kan


Plasmid Map Of Pyes2 Gaa The Ecorv Bamhi Restricted Dna Fragment With Download Scientific Diagram


Puc19 Plasmid Cloning Vector Amid Biosciences Protein Engineering Company


Vector And Insert Plasmid Maps A Illustration Of The Clonejet Plasmid Download Scientific Diagram


Addgene Pfl V5 Gw


Puc19 Vector Sino Biological


19 Puc Gw Kan Vector Kerianruaidhri


Addgene Pzcs16 Peft 3 Wrmscarlet Tbb 2 3 Utr In Puc19


Addgene Pcdna3 1 Exrai Akar


Addgene Pbad Ca


Addgene Pembl Si Egfp


Addgene Pcdna3 Sace2v2 4 Igg1


Addgene Pmscarlet H2a C1

Iklan Atas Artikel

Iklan Tengah Artikel 1

Iklan Tengah Artikel 2

Iklan Bawah Artikel